S. meliloti strains were grown at 30°C in tryptone yeast extract (TY) complex selleck medium [56] or Vincent minimal medium (VMM) [57]. When required, antibiotics were supplemented to the media at the following concentrations: neomycin, 100 μg/ml; kanamycin, 50 μg/ml; and streptomycin, 600 μg/ml. The pH of the VMM was adjusted by using either HCl or NaOH.

Table 1 Bacterial strains, plasmids and PCR primers used in this study   Characteristics Reference Sinorhizobium meliloti     Rm 1021 Spontaneous mutant of wild type strain RU47, Smr [64] Rm 1021ΔrpoE1 Rm1021 derivative, rpoE1 mutant This study Rm 1021ΔrpoE2 Rm1021 derivative, rpoE2 mutant This study Rm 1021ΔrpoE5 Rm1021 derivative, rpoE5 mutant This study Rm 1021ΔrpoH1 Rm1021 derivative, rpoH1 mutant This study

Rm 1021ΔfecI Rm1021 derivative, fecI mutant This study Escherichia coli     DH5_MCR F- endA1 supE44 thi-1 λ- recA1 gyrA96 relA1 deoR Δ(lacZYA-argF)U169 ϕ80dlacZΔM15 Akt inhibitor mcrA Δ(mrr hsdRMS mcrBC) [65] S17-1 E. coli 294::[RP4-2(Tc::Mu)(Km::Tn7)] pro res ΔrecA Tpr [55] Plasmids     pK18mobsacB pUC18 derivative, sacB lacZα Kmr, mobilizable [58] pJrpoH1 pJN105 derivative, rpoH1, Gmr This study Primers     DEL_rpoE1_A AGTAGGATCCGCGATCAGGAGGTCAT This study DEL_rpoE1_B GTCCTTCATCGCTTCGGCAACCGGCATCAATTCCAG This study DEL_rpoE1_C CTGGAATTGATGCCGGTTGCCGAAGCGATGAAGGAC This study DEL_rpoE1_D AGTCGGATCCACGATCCTCTGCGTTGAAGC This study DEL_rpoE2_A ATCGGAATTCGCTCGTCCTCGATGAT This study DEL_rpoE2_B AACGAAGGCACGCGAGGTGACACGCTTGAACTCTTGG Sclareol This study DEL_rpoE2_C CCAAGAGTTCAAGCGTGTCACCTCGCGTGCCTTCGTT This study DEL_rpoE2_D AGCGGAATTCAACCGCGACGGTTCCTATC

This study DEL_rpoE5_A GCGCAAGCTTCTGCAGGATGGAAGCGATT This study DEL_rpoE5_B CTCGTCCGCTCAGTTCAATTGTCGCGATGCGTGACC This study DEL_rpoE5_C GGTCACGCATCGCGACAATTGAACTGAGCGGACGAG This study DEL_rpoE5_D ACGTAAGCTTGCCGACCAGAACCGTAA This study DEL_rpoH1_A CGAAGACAGCGACGATGCAC This study DEL_rpoH1_B ACCAGCCAATCCTGCCACTGCTCGAACTTCTTGACCGCCT This study DEL_rpoH1_C AGGCGGTCAAGAAGTTCGAGCAGTGGCAGGATTGGCTGGT This study DEL_rpoH1_D TATGAAGAGAGGCTCGGCCA This study DEL_fecI1_A CGCGCATTGGTCGTGCGATT This study DEL_fecI1_B GGTGCCGCAGGTACATGTGA This study DEL_fecI1_C TCACATGTACCTGCGGCACCAGGCCTCGACCATGACGAAT This study DEL_fecI1_D this website GATCGTGCGCCACATCGAAG This study Construction of sigma factor mutants The protocols of Sambrook et al. [55] were used for DNA manipulations. DNA fragments containing at least 500 base-pair deletions in the sigma factor genes were constructed by Gene Splicing by Overlap Extension or gene SOEing [31]. In general, most of the coding sequence of the genes was deleted, and only the nucleotides coding for the first and last two amino acids of the genes are still present in the mutant strains. In a first Polymerase chain reaction (PCR), regions up- and downstream of the desired deletion were amplified, and then they were fused in a second PCR. The primers used for this purpose are listed in Table 1.