Activation of Gonadotropin-releasing Hormone Receptor Impedes the Immunosuppressive Activity of Decidual Regulatory T Cells via Deactivating the Mechanistic Target of Rapamycin Signaling
Xuejin Wanga†, Liangying Zhongb†, Qiaodan Liuc, Peiya Caid, Peiru Zhangd, Zhilan Lue, Xiaoqin Lie, and Jin Liu e A Department of Reproductive Medicine, Shenzhen Zhongshan Urology Hospital, Shenzhen, Guangdong,People’s Republic of China; bDepartment of Laboratory Medicine, The First Affiliated Hospital, Sun Yat-sen University, Guangzhou, Guangdong, People’s Republic of China; cDepartment of Head and Neck Oncology, The Cancer Center of the Fifth Affiliated Hospital of Sun Yat-sen University, Zhuhai, Guangdong, People’s Republic of China; dDepartment of Obstetrics and Gynecology, The Second Affiliated Hospital, Fujian Medical University, Quanzhou, Fujian, People’s Republic of China; eDepartment of Preventive Medicine, School of Public Health, Fujian Medical University, Fuzhou, Fujian Province, People’s Republic of China
KEYWORDS
Decidual regulatory T cells; gonadotropin-releasing hormone receptor; maternal immune tolerance
Introduction
The development of an antigenically disparate fetus in the uterus poses a substantial immu- nological challenge to the mother. Understanding immune tolerance at the fetomaternal interface is crucial for designing therapeutics for recurrent spontaneous abortion. However, the cellular and molecular mechanisms underlying the maternal immune tolerance for the fetal expression of paternal major histocompatibility complex remain largely elusive. Two regulatory cell types, Foxp3+ regulatory T cells (Tregs) and decidual macrophages, actively participate in the establishment and maintenance of maternal immune tolerance and home- ostasis at the maternal-fetal interface(Li et al. 2017; Schumacher et al. 2018).
The significance of Tregs to the maternal immune tolerance of semiallogeneic fetuses is a persistent research hot spot. Tregs in the pregnant uterus have a phenotype indicating the majority are of thymic origin and a small proportion are of peripheral origin (Moldenhauer et al. 2019). It has been reported that maternal circulating Tregs are expanding during the pregnancy period(Aluvihare et al. 2004; Dimova et al. 2011). Adoptive transfer of preg- nancy-induced CD4+CD25+ Treg-containing cells effectively reduces fetal rejection in a mouse abortion model(Wang et al. 2014). Decidual Tregs produce suppressive cytokines, for example, transforming growth factor-β (TGF-β), IL-10, and IL-35 to inhibit the activa- tion of other immune cells(Deshmukh and Way 2019). Furthermore, by other means, such as the expression of cytotoxic T lymphocyte antigen-4 (CTLA-4) and programmed death ligand-1 (PD-L1), Tregs induces apoptosis of potentially detrimental activated maternal effector T cells during pregnancy(Habicht et al. 2007; Heikkinen et al. 2004). However, the factors contributing to the recruitment, maintenance, and functional alterations of decidual Tregs are largely undefined.
Gonadotropin-releasing hormone receptor (GnRHR) is mainly expressed on pituitary gonadotrope cells. Its ligand, GnRH, is secreted by hypothalamus, pituitary, and non- hypothalamic reproductive tissues such as ovaries, placenta, endometrium, oviducts, testes, prostrate, and mammary glands (Ramakrishnappa et al. 2005). In contrast with non- pregnant women, GnRH is measurable with pulsatile fluctuations in maternal blood during pregnancy (Petraglia et al. 1994). Upon binding to gonadotropin-releasing hormone (GnRH), GnRHR is activated to regulate the synthesis and secretion of the gonadotropins (Flanagan and Manilall 2017). Previous studies indicated the presence of GnRHR mRNA in human peripheral blood mononuclear cells (Chen et al. 1999). Recent studies suggested that GnRHR agonists might induce pro-inflammatory differentiation of T cells (N. Sung et al. 2015, 2016). However, the role of GnRHR in the modulation of immune cell functions is poorly understood. Particularly, the effect of GnRHR on the development and immuno- suppressive activity of Tregs remains completely unknown.
In this research, for the first time, we discovered the up-regulation of GnRHR in decidual Tregs in a murine allogeneic pregnancy model. Using lentivirus-mediated overexpression or knockdown of GnRHR in Tregs, our data demonstrated the inhibitory effect of GnRHR signaling on Treg function in the decidua. Therefore, this research unveils a novel mechan- ism by which the immunosuppressive function of decidual Tregs is modulated, and deepens our understanding of maternal immune tolerance.
Materials and methods
Murine allogeneic pregnancy model
The animal experiments were designed and performed in compliance with the Fujian Medical University Guidelines for the Use of Animals after approval from the Fujian Medical University Animal Care and Use Committee. Eight-week-old wild type C57BL/6 J males, wild type BALB/c females, and BALB/c nu/nu (i.e. nude mice) females were pur- chased from Shanghai Model Organisms Center Inc. Foxp3-GFP transgenic mice (C57BL/ 6 J background) were purchased from the Jackson Laboratory and transferred by Beijing Vital River Laboratory Animal Technology Co., Ltd. BALB/c or BALB/c nu/nu females were fertilized by C57BL/6 J males. At 14.5 days post coitum (d.p.c.), the pregnant BALB/c females were sacrificed by inhalation of CO2 before further experiments were conducted.Isolation of splenic and decidual immune cells
To harvest splenocytes, mouse spleens were collected, minced, and filtered through 70-µm cell strainers. Erythrocytes were lysed in ACK Lysis Buffer (NovoBiotechnology, CO., Ltd.). Splenocytes were resuspended in ice-cold phosphate-buffered saline (PBS) before further assays.
At 14.5 d.p.c., each decidual-placental unit was separated from each embryo and the implantation site. After rinsing with ice-cold PBS, the placenta was carefully separated from the decidua, and all deciduas were pooled. The deciduas were then cut into small fragments and incubated in the digestion buffer (RPMI1640 medium containing 1 mg/ml Collagenase A, 100 U/ml DNase I, 10% fetal bovine serum, and 5 mM CaCl2. All reagents were purchased from Sigma-Aldrich) for 30 min at 37°C. The digested tissues were then passed through 70-μm cell strainers. After centrifugation at 250 rcf for 5 min at 4°C, the cell pellet was resuspended in ACK lysis buffer for 5 min at room temperature, and then centrifuged for 5 min at 250 rcf. The cell pellet was resuspended in 3 ml of 80% Percoll, and overlaid by the same volume of 40% Percoll. After centrifugation at 1500 rcf for 20 min, mononuclear cells at the interlayer were collected and washed with PBS before further assays.
Flow cytometry assay
The APC anti-TCRβ antibody (H57-597), APC-Cy7 anti-CD4 antibody (GK1.5), PE/Cy7 anti-CD8a antibody (53–6.7), PE/Cy7 anti-IL-17 (TC11-18H10.1), Alexa Fluor® 647 anti- PCNA antibody (PC10), APC goat anti-mouse IgG, and the APC Annexin V Apoptosis Detection Kit with 7-AAD were purchased from Biolegend. The GnRHR monoclonal antibody (F1G4) recognizing an epitope on the extracellular domain of GnRHR was purchased from Abeomics, Inc. Rabbit polyclonal anti-phospho-mTOR (S2448) was pur- chased from Abcam (Cambridge, United Kingdom). To stain cell surface molecules, cells were incubated with 1 µg/ml antibody on ice for 20 min. For GnRHR staining, cells were further incubated with 2 µg/ml APC goat anti-mouse IgG for 15 min on ice after incubation with the primary antibody. Dead cells were excluded by staining with propidium iodide (2 µg/ml). To stain PCNA, cells were fixed with 4% paraformaldehyde for 20 min at room temperature, permeabilized with 90% methanol-PBS for 30 minutes on ice, and incubated with 5 µg/ml Alexa Fluor® 647 anti-PCNA antibody for 1 h at room temperature. Cell apoptosis was detected using the APC Annexin V Apoptosis Detection Kit with 7-AAD following the vendor’s manual. Apoptotic cells were identified as Annexin V+ cells. Cells were analyzed on a BD LSRII flow cytometer. Cell sorting was performed on a BD Influx™ cell sorter.
Quantitative RT-PCR (qRT-PCR)
Cellular RNAs were purified using the Eastep RNA Extraction Kit (Promega). mRNAs were reversely transcribed into cDNAs using the VigoScript cDNA Synthesis Kit (Vigorous Biotechnology). Quantitative PCR was conducted using the SYBR® Green Master Mix (ThermoFisher Scientific) on a 7300 thermocycler (Invitrogen). Primer sequences are shown in Supplementary Table 1.
Magnetic-activated cell sorting (MACS)
Splenic CD4+CD25+ Treg-enriched cells and CD4+CD25− conventional T cells were posi- tively and negatively sorted using the EasySep™ Mouse CD25 Regulatory T Cell Positive Selection Kit (Stemcell Technologies), respectively, following the vendor’s instructions.
Western blot
Cellular proteins were extracted through lysine cells on ice with RIPA buffer (ThermoFisher Scientific) containing the phosphatase inhibitor cocktail and protease inhibitor cocktail (Sigma-Aldrich). mTOR antibody (#2972), phospho-mTOR (Ser2448) antibody (#2971), and GAPDH antibody (#5174) were purchased from Cell Signaling Technology.
Lentiviral infection
pLenti-GIII-CMV-GFP-2A-Puro and piLenti-siRNA-GFP vector were purchased from Applied Biological Materials Inc. The mouse GnRHR VersaClone cDNA (Isoform 1) was purchased from R&D Systems. Cloning of GnRHR cDNA into pLenti-GIII-CMV-GFP-2A- Puro vector was accomplished by BioWit Technologies (Shen Zhen, China). Design of GnRHR shRNA, construction of GnRHR shRNA lentiviral vector, and lentivirus prepara- tion were also completed by BioWit Technologies. The GnRHR shRNA sequence is 5ʹ- GATCCGAGTGACCGTGACTTTTCAAGAGAAAGTCACGGTCACTCGGATC-3ʹ. The GnRHR-expressing lentivirus was termed GL, and the control lentivirus was termed CL. The GnRHR shRNA-expressing lentivirus was termed Gsh-L, and the scramble control lentivirus was termed Csh-L. The maps of the lentiviral vectors are shown in Figure S1. 1 × 106/ml CD4+CD25+ Tregs were cultured in RPMI1640 supplemented with 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin, in the presence of 5 µg/ml plate-bound CD3e antibody (eBioscience), 2 µg/ml soluble CD28 antibody (eBioscience), and 10 ng/ml recombinant mouse IL-2 (R&D Systems) for 1 day. After that, polybrene (Sigma-Aldrich) was added into the culture at the final concentration of 5 µg/ml. Lentiviral particles were added into cell culture at the multiplicity of infection (MOI) of 10 and incubated for 16 hours. Cells were then cultured for additional 2 days in the presence of 2 µg/ml puromycin to select successfully infected cells. The infection efficiency was deter- mined by calculating the percentage of GFP+ cells on the flow cytometer. GFP+ cells, i.e. successfully transduced Tregs, were then sorted by flow cytometry for further experiments.
Cell culture, treatment, and suppression assay
Lentivirus-infected Tregs were cultured in supplemented RPMI1640 medium in the presence of 5 µg/ml plate-bound CD3e antibody, 2 µg/ml soluble CD28 antibody, and 10 ng/ml mouse IL-2. Leuprolide acetate (Sigma-Aldrich) was added into the culture at the final concentration of 100 nM for 24 hours. In some experiments, the mTOR activator MHY1485 (EMD Millipore) was simultaneously added into the culture at the final concentration of 10 µM.
To evaluate Treg suppressive activity, 1 × 106/ml splenic CD4+CD25− conventional T cells were labeled with CellTrace Far Red (ThemoFisher Scientific). Labeled conventional T cells were then mixed with lentivirus-infected Tregs at the ratio of 1:1. 100 µl of mixed cells were placed into each well of 96-well plates that coated with 5 µg/ml CD3e antibody, 2 µg/ml soluble CD28 antibody, 10 ng/ml mouse IL-2, and 100 nM leuprolide acetate. In some experiments, lentivirus-infected Tregs were pre-treated with 10 µM MHY1485 for 6 hours before co-culture with conventional T cells. On day 6 after co-culture, the dilution of CellTrace Far Red in conventional T cells was assessed by flow cytometry.
To determine the effect of leuprolide on primary decidual Tregs, decidual CD4+ GFP+ Tregs were sorted from Foxp3-GFP transgenic mice. 1 × 105/ml decidual Tregs were treated with 1 µM leuprolide acetate with or without 10 µM MHY1485 for 24 hours. Cells were then subjected to RNA extraction and qRT-PCR.
To determine the effect of leuprolide on total decidual T cells, TCR+ T cells were sorted from pregnant Foxp3-GFP transgenic mice at 14.5 ~ 15.5 d.p.c. T cells were then stimulated with 5 µg/ml plate-bound CD3e antibody, 2 µg/ml soluble CD28 antibody, and 10 ng/ml mouse IL-2 in the presence or absence of 100 nM leuprolide acetate for 3 days. Six hours before the end of stimulation, 5 μg/ml brefeldin A and 5 μg/ml monensin (Both from Sigma-Aldrich) were added into the culture. Cells were then subjected to flow cytometry to detect either Foxp3-GFP+ or IL-17+ T cells, respectively.
Adoptive transfer
Wild type BALB/c females were fertilized by C57BL/6 J males. At 12.5–14.5 d.p.c., spleno- cytes were prepared from pregnant BALB/c mice. CD4+CD25+ T cells were then depleted from splenocytes by MACS as described above. Splenocytes depleted of CD25+ T cells were mixed with non-infected or lentivirus-infected Tregs at 20:1. Each BALB/c nu/nu female was retro-orbitally injected with 200 µl of saline containing 2 × 107 mixed cells consisting of splenocytes and lentivirus-infected Tregs. The recipients then mated with C57BL/6 J males. Only females that had received a vaginal plug within 3 days of cell transfer were subjected to further analysis. At 14.5 d.p.c., the recipients were sacrificed, the uteri were removed, and the implantation sites were recorded. The abortion sites were identified by the small size with a necrotic and hemorrhagic appearance. The abortion rate was calculated as the ratio of resorption sites to total implantation sites. Furthermore, the deciduas were harvested for the isolation of decidual mononuclear cells as described above.
Statistical analysis
All experiments were independently conducted two or three times, with 3 to 8 samples in each group. All data were analyzed by GraphPad Prism 7.0 and are presented as mean ± standard error of the mean. Student’s t-test or one-way ANOVA with Tukey post hoc test was used for statistical analysis. A p-value < 0.05 was considered significant.
Results
T cells up-regulate GnRHR expression in the decidua
To characterize the expression of GnRHR in decidual T cells, we isolated mononuclear cells from spleens and deciduas of pregnant Foxp3-GFP transgenic mice at 14.5 d.p.c. TCR+CD4+ T cells and TCR+CD8+ T cells were recognized in total decidual mononuclear cells (Figure 1(a)). Next, GFP+ cells, i.e. Foxp3+ Tregs, were distinguished among TCR+CD4+ T cells (Figure 1(a)). Tregs were then sorted by flow cytometry and the GnRHR transcript was quantified by qRT-PCR. In our pilot study, we found that the GnRHR transcript in Tregs primarily encoded GnRHR isoform 1 (Data not shown). As shown in Figure 1(b), compared with the pituitary gland, the quantity of GnRHR transcript was very low in splenic CD4+Foxp3− conventional T cells, CD8+ T cells, and Tregs regardless of pregnancy. However, the GnRHR transcript was significantly increased in decidual T cell counterparts (Figure 1(b)). Particularly, decidual Tregs expressed the most abundant GnRHR transcript among the T cell subsets (Figure 1(b)). To confirm the up- regulation of GnRHR, GnRHR protein was detected on the surface of each T cell subset by flow cytometry. As indicated in Figure 1(c), GnRHR was very weakly expressed on splenic T cell subsets. However, decidual T cell subsets expressed higher GnRHR, with the highest GnRHR expression on decidual Tregs.
Leuprolide-induced GnRHR activation decreases functional molecules in GnRHR-overexpressing Tregs
Considering the limited amount of decidual Tregs, it is difficult to harvest sufficient decidual Tregs for functional analysis. Therefore, we decided to use a lentivirus system to overexpress GnRHR in splenic Tregs, because GnRHR expression is so few in splenic Tregs as shown in Figure 1. To this end, CD4+CD25+ Tregs were enriched from C57BL/6 J mouse spleens, cultured in vitro, and transduced with lentiviral particles. The lentivirus encodes both GnRHR isoform 1 and GFP, so the GFP intensity tells the transduction efficiency. After lentiviral transduction, about 65% of Tregs were GFP+ (Figure 2(a)), and GnRHR protein was considerably elevated on the surface of GFP+ Tregs (i.e. successfully transduced Tregs) (Figure 2(b)). The lentiviral transduction and GnRHR overexpression did not significantly impact Treg apoptosis or necrosis (Figure 2(c)). Next, we treated these lenti- virus-transduced Tregs with leuprolide (a GnRHR agonist) and then evaluated the expres- sion of an array of Treg functional molecules. As shown in Figure 2(d), leuprolide did not change the expression of IL-10 (IL10), TGF-β (TGFB1), IL-35 subunits Ebi3 (EBI3) and IL12a (IL12A), and Foxp3 (FOXP3) in Tregs transduced with the control lentivirus. However, leuprolide induced down-regulation of IL-10 and Ebi3 in GnRHR- overexpressing Tregs, in comparison to Tregs transduced with the control lentivirus. Interestingly, leuprolide also decreased Foxp3 expression by about 40% in GnRHR- overexpressing Tregs (Figure 2(d)). Further analysis revealed that the expression of CD25 (IL2RA), GITR (TNFRSF18), and ICOS (ICOS) in control Tregs was not altered by
Figure 1. Decidual Tregs up-regulate GnRHR. (a) Flow cytometry dot plots indicating the gating of splenic or decidual Tregs in mononuclear cells isolated from Foxp3-GFP mice at 14.5 d.p.c. The numbers in the plots are the percentages of gated cells. NS: spleens of normal non-pregnant mice. PS: spleens of pregnant mice. PD: deciduas of pregnant mice. (b) qRT-PCR quantification of GnRHR transcripts in all conventional CD4+Foxp3− T cells, CD8+ T cells, and Tregs sorted from spleens or deciduas. The pituitary gland tissue was used as a positive control. N = 6 pregnant mice per group. (c) Quantification of GnRHR protein on the surface of all conventional CD4+Foxp3− T cells, CD8+ T cells, and Tregs in spleens or deciduas. Left panel: representative flow cytometry histograms. Right panel: statistics of the mean fluorescence intensity of GnRHR. Isotype: isotype antibody control. N = 4 pregnant mice per group. Mean ± SEM. *: p < .05; ***: p < .001. leuprolide, while the expression of these molecules in GnRHR-overexpressing Tregs was decreased by leuprolide (Figure 2(e)). Leuprolide did not influence the expression of T-bet (TBX21, Th1 master regulator), Gata3 (GATA3, Th2 master regulator), and RORc (RORC, Th17 master regulator) in either control Tregs or GnRHR-overexpressing Tregs (Figure 2 (f)). Consistently, leuprolide did not alter the expression of IFN-γ (IFNG), IL-4 (IL4), IL-17 (IL17), and IL-22 (IL22) in control Tregs or GnRHR-overexpressing Tregs (Figure 2(g)). Of note, without leuprolide, GnRHR overexpression alone did not induce changes in the expression of the above molecules (Figure 2(d to g)).
Figure 2. GnRHR activation down-regulates Treg functional molecules in vitro. (a) GFP expression in wild type splenic CD4+CD25+ Tregs two days after transduction with lentivirus encoding both GnRHR and GFP. Non-transduced: Tregs without transduction. GL: Tregs transduced with GnRHR-encoding lentivirus. (b) GnRHR protein on surface of GFP+ Tregs (i.e. successfully transduced Tregs) two days after lentiviral transduction. CL: control-lentivirus-transduced Tregs. GL: GnRHR-encoding-lentivirus-transduced Tregs.
(c) Treg apoptosis and necrosis after lentiviral transduction. The data in (a) to (c) represent 2 independent experiments. (d to g) q-RT-PCR quantification of the transcripts of indicated molecules in lentivirus- transduced Tregs after 24-hour leuprolide (a GnRH agonist) treatment. V: vehicle. Le: leuprolide. In (d) and (e), N = 6 independent samples per group. In (F) and (G), N = 3 independent samples per group. Mean ± SEM. *: p < .05; **: p < .01; ***: p < .001.
Leuprolide impairs the suppressive function of GnRHR-overexpressing Tregs
To check the impact of GnRHR on Treg activity, we first assessed Treg proliferation based on PCNA staining. As shown in Figure 3(a), in the absence of leuprolide, the proportion of proliferative Tregs (i.e. PCNA+ Tregs) in GnRHR-overexpressing Tregs was equivalent to the proportion of proliferative Tregs in control Tregs. Leuprolide did not change the percentage of PCNA+ cells in control Tregs, while it remarkably diminished the percentage of PCNA+ cells in GnRHR-overexpressing Tregs. Therefore, GnRHR activation decelerated Treg proliferation. Next, we appraised the suppressive activity of Tregs through co- culturing Tregs with activated CD4+CD25− conventional T cells in the presence of leupro- lide. Of note, leuprolide did not influence the dilution of Cell Trace Far Red when conventional T cells were cultured alone, suggesting that leuprolide did not affect the proliferation of conventional T cells (Figure 3(b)). In the presence of leuprolide, control Tregs profoundly inhibited the proliferation of conventional T cells, whereas GnRHR-
Figure 3. GnRHR activation reduces Treg suppressive function in vitro. (a) Treg proliferation determined by PCNA staining. Left panel: representative histograms. Right panel: statistics of the percentages of PCNA+ Tregs. Isotype: isotype antibody control. CL: control-lentivirus-transduced Tregs. GL: GnRHR- encoding-lentivirus-transduced Tregs. V: vehicle. Le: leuprolide. (b) CellTrace Far Red dilution in splenic CD4+CD25− conventional T cells after 6-day stimulation in the presence or absence of lentivirus- transduced Tregs and leuprolide. Conv T alone: conventional T cells cultured alone. Conv T+ Treg-CL: conventional T cells co-cultured with control-lentivirus-transduced Tregs. Conv T+ Treg-GL: conventional T cells co-cultured with GnRHR-encoding-lentivirus-transduced Tregs. The shaded curve indicates non- stimulated conventional T cells. Left panel: representative histograms. Right panel: statistics of the mean fluorescence intensity of CellTrace Far Red. N = 4 independent samples per group. Mean ± SEM. *: p < .05;
***: p < .001. overexpressing Tregs just mildly suppressed the proliferation of conventional T cells, as evidenced by the more diluted Cell Trace Far Red in conventional T cells after co-culture with GnRHR-overexpressing Tregs (Figure 3(b)).
Leuprolide inhibits the mTOR signal pathway
To further analyze the effect of GnRHR, we evaluated the activation status of the mTOR signal pathway in Tregs, because mTOR is necessary for Treg activity 16, 17. To this end, mTOR phosphorylation was measured in Tregs after leuprolide treatment. We found that in the absence of leuprolide, GnRHR overexpression did not affect mTOR phosphorylation (Figure 4(a)). Leuprolide did not change mTOR phosphorylation in control Tregs but markedly reduced mTOR phosphorylation in GnRHR-overexpressing Tregs (Figure 4(a)). To confirm the role of mTOR signaling, Tregs were co-treated with leuprolide and mTOR activator MHY1485. As shown in Figure 4(b), MHY1485 not only up-regulated the expres- sion of CD25 and ICOS in control Tregs but also counteracted the effect of leuprolide to restore the expression of CD25 and ICOS in GnRHR-overexpressing Tregs. However,
Figure 4. GnRHR influences Treg function through the mTOR signal pathway. (a) mTOR phosphorylation in Tregs determined by Western blot. Left panel: representative blots. Right panel: statistics of mTOR phosphorylation level relative to the “CL-V” group. CL: control-lentivirus-transduced Tregs. GL-V: GnRHR- encoding-lentivirus-transduced Tregs. V: vehicle. Le: leuprolide. N = 3 independent samples per group.
(b) q-RT-PCR quantification of the transcripts of indicated molecules in lentivirus-transduced Tregs after 24-hour leuprolide treatment in the presence or absence of MHY1485. MHY: MHY1485. N = 5 indepen- dent samples per group. (c) CellTrace Far Red dilution in splenic conventional T cells after 6-day stimulation and co-culture with Tregs pre-treated with MHY1485. Note that leuprolide was persistently present in the co-culture system. Conv T alone: conventional T cells cultured alone. Treg-CL: conventional T cells co-cultured with control-lentivirus-transduced Tregs. Treg-CL-MHY: conventional T cells co- cultured with control-lentivirus-transduced Tregs that were pretreated with MHY1485. Treg-GL: conven- tional T cells co-cultured with GnRHR-encoding-lentivirus-transduced Tregs. Treg-GL+MHY: conventional T cells co-cultured with GnRHR-encoding lentivirus-transduced Tregs that were pretreated with MHY1485. Left panel: representative histograms. Right panel: statistics of the mean fluorescence intensity of CellTrace Far Red. N = 4 independent samples per group. (d) q-RT-PCR quantification of the transcripts of indicated molecules in sorted decidual Tregs after 24-hour in vitro treatment with leuprolide with or without MHY1485. N = 5 mice per group. Mean ± SEM. *: p < .05; ***: p < .001.
MHY1485 did not change the expression IL-10 and Foxp3 (Figure 4(b)). Furthermore, in the suppression assay, MHY1485 enhanced control Treg-induced inhibition of conven- tional T cell proliferation (Figure 4(c)). MHY1485 also promoted GnRHR-overexpressing Treg-induced inhibition of conventional T cell proliferation (Figure 4(c)). Furthermore, we sorted decidual GFP+ Tregs from pregnant Foxp3-GFP mice and treated them with leuprolide in the presence or absence of MHY1485. As indicated in Figure 4(d), leuprolide down-regulated the transcripts of CD25, ICOS, and Foxp3, whereas MHY1485 reduced the effect of leuprolide and increased the transcripts of IL-10, CD25, and ICOS.
GnRHR knockdown enhances the suppressive function of decidual Tregs in vivo
Because GnRHR is up-regulated in decidual Tregs, we need to silence GnRHR expression to check its effect in vivo. To this end, we transduced normal splenic Tregs with lentivirus encoding both GnRHR shRNA and GFP (The lentivirus was termed Gsh-L. The control lentivirus encoding a scrambled shRNA was termed Csh-L). The transduction was success- ful, eliciting about 70% of GFP+ Tregs (Figure 5(a)). GnRHR knockdown had no significant effects on Treg apoptosis (Figure 5(b)) or functional molecule expression (Figure 5(c)). These Tregs were mixed with Treg-free splenocytes and transferred into BALB/c nu/nu mice before the recipients were impregnated (Figure 5(d)). At 14.5 d.p.c., GFP+ lentivirus- transduced exogenous Tregs were recovered from spleens and deciduas of the recipients. The proportions of Csh-L-transduced Tregs and Gsh-L-transduced Tregs were similar in either the spleen or decidua (Figure 6(a)), indicating that GnRHR knockdown did not alter the recruitment of Tregs in these tissues. In the spleen, GnRHR expression on either Csh- L-transduced Tregs or Gsh-L-transduced Tregs was very low. In the decidua, Csh- L-transduced Tregs up-regulated GnRHR expression while Gsh-L-transduced Tregs did not, suggesting efficient GnRHR knockdown (Figure 6(b)). Decidual Gsh-L-transduced
Figure 5. Lentivirus-mediated GnRHR knockdown in wild type splenic CD4+CD25+ Tregs. (a) GFP expression in Tregs two days after lentiviral transduction. Non-transduced: Tregs without transduction. Gsh-L: Tregs transduced with GnRHR shRNA-and-GFP-encoding lentivirus. (b) Treg apoptosis and necrosis after lentiviral transduction. (c) qRT-PCR quantification of the transcripts of indicated molecules in lentivirus-transduced Tregs. N = 3 independent experiments. Mean ± SEM. (d) Schematic diagram of the adoptive transfer assay. Please refer to the “Materials and methods” for details.
Figure 6. GnRHR knockdown promotes the suppressive function of decidual Tregs in vivo. (a) Gating of exogenous GFP+ Tregs in splenocytes and decidual mononuclear cells of pregnant BALB/c nu/nu recipients. Csh-L: mice receiving Tregs transduced with scramble shRNA-encoding lentivirus. Gsh-L: mice receiving Tregs transduced with GnRHR shRNA-encoding lentivirus. The data represent 6 mice per group. (b) GnRHR protein on splenic or decidual GFP+ Tregs of pregnant BALB/c nu/nu recipients. Left panel: representative histograms. Right panel: statistics of the mean fluorescence intensity of GnRHR. N = 6 mice per group. (c) Foxp3 transcripts in splenic or decidual GFP+ Tregs of pregnant BALB/c nu/nu recipients. (d) Gating of exogenous GFP−CD4+ and GFP−CD8+ effector T cells in the deciduas of pregnant BALB/c nu/nu recipients. (e) qRT-PCR quantification of the transcripts of indicated cytokines in exogenous GFP−CD4+ or GFP−CD8+ effector T cells in the deciduas of pregnant BALB/c nu/nu recipients. (f) Abortion rates of BALB/c nu/nu recipients. (g) Implantation number of BALB/c nu/nu recipients. N = 6 ~ 8 per group. Mean ± SEM. *: p < .05; ***: p < .001.
Tregs expressed more Foxp3 than decidual Csh-L-transduced Tregs (Figure 6(c)). To assess Treg suppressive activity, exogenous effector CD4+ and CD8+ T cells were sorted from the decidua for the evaluation of cytokine production (Figure 6(d)). In mice receiving Gsh- L-transduced Tregs, decidual effector CD4+ T cells expressed lower IFN-γ and IL-17 in comparison to their counterparts in mice receiving Csh-L-transduced Tregs (Figure 6(e)). Similarly, in mice receiving Gsh-L-transduced Tregs, decidual effector CD8+ T cells expressed lower IFN-γ in comparison to their counterparts in mice receiving Csh- L-transduced Tregs (Figure 6(e)). However, the abortion rate and implantation number were equivalent in the two groups (Figure 6(f)), suggesting that a better model would be necessary to analyze the role of GnRHR in maternal immune tolerance.
Leuprolide decreases decidual Tregs and increases decidual IL-17+ T cells
To further determine the effect of GnRHR activation on total decidual T cells, we sorted TCRβ+ total T cells from pregnant Foxp3-GFP mice. These T cells were then stimulated with agonistic antibodies and IL-2 in the presence or absence of 100 nM leuprolide acetate for 3 days. The frequencies GFP+ Tregs and IL-17+ T cells were measured by flow cytometry, respectively. As shown in Figure 7(a) & 7(c), the percentage of Tregs was moderately decreased after leuprolide acetate treatment compared with the vehicle control. However, the percentage of IL-17+ T cells was remarkably increased after leuprolide acetate treatment (Figure 7(b) & 7(c)). Therefore, GnRHR activation down-regulated Tregs and enhance the generation of IL-17+ T cells in decidual T cells.
Figure 7. The frequencies of decidual Tregs and IL-17+ T cells after in vitro treatment with leuprolide. (a & b) Flow cytometry dot plots indicating Foxp3-GFP+ Tregs (a) and IL-17+ T cells (b) after treatment. V: vehicle. Le: leuprolide. (c) Statistics. N = 6 per group. Mean ± SEM. ***: p < .001.
Discussion
The unique properties of Tregs facilitate Tregs to play an active role in immune tolerance and homeostasis during pregnancy. Decidua is the tissue where maternal immune cells contact the fetal-placental unit(Ander et al. 2019). The composition, phenotypical and functional properties of decidual immune have been unveiled (Li et al. 2017; Schumacher et al. 2018). However, the intrinsic and extrinsic factors responsible for modulating decidual Treg activity have not been completely identified.
To our knowledge, our work is the first to characterize the expression and function of GnRHR in Tregs. In humans, GnRHR1 and GnRHR2 are the receptors of GnRH1 and GnRH2, respectively. However, mice lack the GnRHR2 gene (Desaulniers et al. 2017), so the data in our work are for GnRHR1 only. The role of GnRHR in the immune system is almost neglected, probably because GnRH and GnRHR are primarily expressed in the pituitary zone, ovary, testis, and mammary gland (Desaulniers et al. 2017). Only a few studies reported the presence of GnRH binding sites in the spleen and thymus(Batticane et al. 1991; Marchetti et al. 1990; Morale et al. 1991) . Several studies indicated the presence of GnRHR transcripts in human blood mononuclear cells and lymphocytes (Chen et al. 1999; Standaert et al. 1992). Moreover, blockade of central and peripheral GnRHR with a potent GnRH antagonist impaired the cellular and humoral immune responses in neonatal rats and monkeys (Morale et al. 1991). Although these studies suggested the probable functional GnRH-binding sites in lymphocytes, nobody has confirmed the presence of GnRHR protein in immune cells, especially T cell subsets. Besides, what signal pathway(s) is activated in lymphocytes after the binding of GnRH to GnRHR is unknown. Our work proves the expression of GnRHR protein in T cell subsets, and provide insights into the role of mTORC1 signaling in the modulation of Treg function.
First, we discovered that GnRHR expression was very low in splenic T cells including
Tregs, compared with the pituitary tissue. In normal lymphoid organs and tissues, the expression of both GnRH and GnRHR might be very limited, and this is why the effect of GnRH on immune cells is difficult to be perceived. Some studies indicated that treatment with GnRH analogs or antagonists induced the changes of proliferation and activation of T cells (Ho et al. 1995; Mann et al. 1994), suggesting that T cell activity could be altered if the GnRHR-mediated intracellular signals are potent enough. In our work, we found that decidual T cells, including conventional CD4+ T cells, CD8+ T cells, and Tregs, all expressed higher GnRHR than their circulating counterparts. Interestingly, GnRH1, the ligand of GnRHR, is abundantly expressed in decidua(Lee et al. 2010). Specifically, extravillous cytotrophoblasts and decidual stromal cells are two major GnRH-releasing cell types in the decidua (Lee et al. 2010). We can therefore speculate that in the decidua, extravillous cytotrophoblasts and decidual stromal cells produce sufficient GnRH to impact the activity of Tregs that express high GnRHR. Decidua might be a rare and valuable location to observe the effect of GnRH on Tregs. Moreover, our ongoing research is investigating the role of GnRH in the regulation of decidual conventional CD4+ T cells and CD8+ T cells.
Second, we showed that leuprolide, a potent GnRHR agonist, impaired the suppres- sive function of GnRHR-overexpressing Tregs through deactivation of mTOR signaling. This finding implies the negative modulation of Treg function by decidual GnRH- releasing cells. A previous paper mentioned that decidual stromal cells promoted Tregs and suppress alloreactivity in a cell contact-dependent manner (Erkers et al. 2013). Our data suggest, however, decidual stromal cells are also able to alleviate Treg activity in a paracrine manner. Perhaps a delicate balance between immune competence and immune tolerance is required to combat potential pathogen infections in the fetoma- ternal interface, and decidual stromal cell-derived GnRH is the factor that controls Treg activity to sustain necessary immune responses. mTOR signal pathway is important to regulate cell metabolism and behavior. mTOR signaling negatively regulates Treg differ- entiation and expansion(Battaglia et al. 2012; Sun et al. 2018), but is fundamental for the immunosuppressive capacity of Tregs(Zeng et al., 2013; Sun et al. 2018). We found that leuprolide decreased mTOR phosphorylation and Treg function, and mTOR activator MHY1485 counteracted the effect of leuprolide. Hence, deactivation of mTOR signaling is possibly the mechanism of GnRH-mediated change of Treg activity. However, because mTOR signaling seems not directly impacting Foxp3 expression, the mechanism of leuprolide-induced Foxp3 down-regulation needs to be investigated in the future. Of note, previous reports demonstrated that GnRH activated mTOR in gonadotropes (Nguyen et al. 2004; Sosnowski et al. 2000). This suggests that GnRH-induced intracel- lular events in decidual Tregs might be very different from or even opposite to the signal cascades in gonadotropes. Furthermore, it will be necessary to analyze the effect of GnRH on decidual Tregs, although this was not done in the current study due to the lack of commercially available bioactive mouse GnRH. Besides, GnRHR activation also triggers other signal pathways such as PKA, ERK1/2, CREB, etc(Perrett and McArdle 2013). Whether these pathways impact decidual Treg function needs further studies.
Third, although the up-regulation of GnRHR was observed, what factor(s) induced this change remains a mystery. Interestingly, it has been reported that GnRH treatment aug- mented GnRHR mRNA in blood mononuclear cells (Chen et al. 1999). Because GnRH is abundant in the decidua, it likely induces the up-regulation of GnRHR in T cells. This hypothesis will be tested in our future studies.
In summary, we identified the negative role of GnRHR in decidual Treg-mediated maternal tolerance. This work deepens our understanding of immune regulation in the fetomaternal interface, and might provide clues to analyze immunological pregnancy complications such as spontaneous abortion.
References
Aluvihare VR, Kallikourdis M, Betz AG. 2004. Regulatory T cells mediate maternal tolerance to the fetus. Nat Immunol. 5:266–71.
Ander SE, Diamond MS, Coyne CB. 2019. Immune responses at the maternal-fetal interface. Sci Immunol. 4(31):eaat6114.
Battaglia M, Stabilini A, Tresoldi E. 2012. Expanding human T regulatory cells with the mTOR-inhibitor rapamycin. Methods Mol Biol. 821:279–93.
Batticane N, Morale MC, Gallo F, Farinella Z, Marchetti B. 1991. Luteinizing hormone-releasing hormone signaling at the lymphocyte involves stimulation of interleukin-2 receptor expression. Endocrinology. 129:277–86.
Chen HF, Jeung EB, Stephenson M, Leung PC. 1999. Human peripheral blood mononuclear cells express gonadotropin-releasing hormone (GnRH), GnRH receptor, and interleukin-2 receptor gamma-chain messenger ribonucleic acids that are regulated by GnRH in vitro. J Clin Endocrinol Metab. 84:743–50.
Desaulniers AT, Cederberg RA, Lents CA, White BR. 2017. Expression and role of gonadotropin-releasing hormone 2 and its receptor in mammals. Front Endocrinol (Lausanne). 8:269.
Deshmukh H, Way SS. 2019. Immunological basis for recurrent fetal loss and pregnancy complications. Annu Rev Pathol. 14:185–210.
Dimova T, Nagaeva O, Stenqvist AC, Hedlund M, Kjellberg L, Strand M, Dehlin E, Mincheva-Nilsson
L. 2011. Maternal Foxp3 expressing CD4+ CD25+ and CD4+ CD25- regulatory T-cell populations are enriched in human early normal pregnancy decidua: a phenotypic study of paired decidual and peripheral blood samples. Am J Reprod Immunol. 66(Suppl 1):44–56.
Erkers T, Nava S, Yosef J, Ringden O, Kaipe H. 2013. Decidual stromal cells promote regulatory T cells and suppress alloreactivity in a cell contact-dependent manner. Stem Cells Dev. 22:2596–605.
Flanagan CA, Manilall A. 2017. Gonadotropin-releasing hormone (GnRH) receptor structure and GnRH binding. Front Endocrinol (Lausanne). 8:274.
Habicht A, Dada S, Jurewicz M, Fife BT, Yagita H, Azuma M, et al. 2007. A link between PDL1 and T regulatory cells in fetomaternal tolerance. J Immunol. 179:5211–19.
Heikkinen J, Mottonen M, Alanen A, Lassila O. 2004. Phenotypic characterization of regulatory T cells in the human decidua. Clin Exp Immunol. 136:373–78.
Ho HN, Chen HF, Chen SU, Chao KH, Yang YS, Huang SC, Lee TY, Gill TJ. 1995. Gonadotropin releasing hormone (GnRH) agonist induces down-regulation of the CD3+CD25+ lymphocyte subpopulation in peripheral blood. Am J Reprod Immunol. 33(3):243–52.
Lee HJ, Snegovskikh VV, Park JS, Foyouzi N, Han KT, Hodgson EJ, Guller S, Norwitz ER. 2010. Role of GnRH-GnRH receptor signaling at the maternal-fetal interface. Fertil Steril. 94(7):2680–87.
Li S, Zhang X, Zhang R, Liang Z, Liao W, Du Z, Gao C, Liu F, Fan Y, Hong H. 2017. Hippo pathway contributes to cisplatin resistant-induced EMT in nasopharyngeal carcinoma cells. Cell Cycle. 16 (17):1601–1610.
Mann DR, Ansari AA, Akinbami MA, Wallen K, Gould KG, McClure HM. 1994. Neonatal treatment with luteinizing hormone-releasing hormone analogs alters peripheral lymphocyte subsets and cellular and humorally mediated immune responses in juvenile and adult male monkeys. J Clin Endocrinol Metab. 78:292–98.
Marchetti B, Guarcello V, Morale MC, Bartoloni G, Palumbo G Jr., Raiti F, Cutuli N, Farinella Z, Scapagnini U. 1990. A physiological role for the neuropeptide luteinizing hormone-releasing hor- mone (LHRH) during the maturation of thymus gland function. Int J Neurosci. 51(3–4):287–89.
Moldenhauer LM, Schjenken JE, Hope CM, Green ES, Zhang B, Eldi P, Hayball JD, Barry SC, Robertson SA. 2019. Thymus-derived regulatory T cells exhibit Foxp3 epigenetic modification and phenotype attenuation after mating in mice. J Immunol. 203(3):647–657.
Morale MC, Batticane N, Bartoloni G, Guarcello V, Farinella Z, Galasso MG, Marchetti B. 1991. Blockade of central and peripheral luteinizing hormone-releasing hormone (LHRH) receptors in neonatal rats with a potent LHRH-antagonist inhibits the morphofunctional development of the thymus and maturation of the cell-mediated and humoral immune responses. Endocrinology. 128(2):1073–85.
Nguyen KA, Santos SJ, Kreidel MK, Diaz AL, Rey R, Lawson MA. 2004. Acute regulation of translation initiation by gonadotropin-releasing hormone in the gonadotrope cell line LbetaT2. Mol Endocrinol. 18:1301–12.
Perrett RM, McArdle CA. 2013. Molecular mechanisms of gonadotropin-releasing hormone signal- ing: integrating cyclic nucleotides into the network. Front Endocrinol (Lausanne). 4:180.
Petraglia F, Genazzani AD, Aguzzoli L, Gallinelli A, De Vita D, Caruso A, Genazzani AR. 1994. Pulsatile fluctuations of plasma-gonadotropin-releasing hormone and corticotropin-releasing factor levels in healthy pregnant women. Acta Obstet Gynecol Scand. 73(4):284–89.
Ramakrishnappa N, Rajamahendran R, Lin YM, Leung PC. 2005. GnRH in non-hypothalamic reproductive tissues. Anim Reprod Sci. 88:95–113.
Schumacher A, Sharkey DJ, Robertson SA, Zenclussen AC. 2018. Immune cells at the fetomaternal interface: how the microenvironment modulates immune cells to foster fetal development. J Immunol. 201:325–34.
Sosnowski R, Mellon PL, Lawson MA. 2000. Activation of translation in pituitary gonadotrope cells by gonadotropin-releasing hormone. Mol Endocrinol. 14:1811–19.
Standaert FE, Chew BP, De Avila D, Reeves JJ. 1992. Presence of luteinizing hormone-releasing hormone binding sites in cultured porcine lymphocytes. Biol Reprod. 46:997–1000.
Sun IH, Oh MH, Zhao L, Patel CH, Arwood ML, Xu W, Tam AJ, Blosser RL, Wen J, Powell JD. 2018. mTOR complex 1 signaling regulates the generation and function of central and effector Foxp3(+) regulatory T cells. J Immunol. 201(2):481–492.
Sung N, Mdsg S, Kwak-Kim DJ. 2015. GNRH agonist induces TH1 and TH17 immunity, while GNRH antagonist suppresses TH1 immunity. Fertil Steril. 104(Supplement):E61.
Sung N, Salazar Garcia MD, Dambaeva S, Beaman KD, Gilman-Sachs A, Kwak-Kim J. 2016. Gonadotropin-releasing hormone analogues lead to pro-inflammatory changes in T lymphocytes. Am J Reprod Immunol. 76:50–58.
Wang WJ, Liu FJ, Xin-Liu, Hao CF, Bao HC, Qu QL, Liu XM. 2014. Adoptive transfer of pregnancy-induced CD4+CD25+ regulatory T cells reverses the increase in abortion rate caused by interleukin 17 in the CBA/JxBALB/c mouse model. Hum Reprod. 29(5):946–52.
Zeng H, Yang K, Cloer C, Neale G, Vogel P, Chi H. 2013. mTORC1 couples immune signals and metabolic programming to establish T(reg)-cell function. Nature. 499:485–90.