The PCR product was cut by XbaI and XhoI, and cloned into PUC19-35S-MCS-GFP, PUC19-35S-MCS-YFP N and PUC19-35S-MCS-YFP C which were constructed as previously described [32, 33]. These gene manipulations generated PUC19-35S-AtMinD-GFP, PUC19-35S-AtMinD-YFP N and PUC19-35S-AtMinD-YFP C . To obtain appropriate localization of EcMinC which had no chloroplast transit peptide, we used the first 58 amino acid residues from the Rubisco small subunit

(At5g38410) in Arabidopsis thaliana. The coding region Cilengitide order was amplified with primers TPF, GCTCTAGAGTAATGGCTTCCTCTATGCTC and TPR, GCGGATCCCTTCATGCAGCTAACTCTTCC, cloned into PUC19-35S-MCS-GFP between XbaI and BamHI cutting sites to obtain PUC19-35S-TP-GFP. EcMinC (GeneBank J03153) EX 527 datasheet was PCR-amplified with primers MinCF, GCGGATCCATGTCAAACACGC CAATCG and MinCR, GCCTCGAGATTTAACGGTTGAACGGTCAAAG and cut by BamHI and XhoI and cloned into the above vector to generate PUC19-35S-TP-MinC-GFP. The GFP gene in PUC19-35S-TP-MinC-GFP was replace with YFPN and YFPC to generate PUC19-35S-TP-MinC-YFP N and PUC19-35S-TP-MinC-YFP C . For the localization and BiFC protein interaction analysis of AtMinD and EcMinC, the above constructs were transformed or cotransformed into Arabidopsis protoplasts by PEG-mediated method

[34]. Microscopy and phenotype analysis Differential interference contrast (DIC) microscopy and fluorescence microscopy were done by using Leica multifunctional microscope. The fluorescence in Arabidopsis protoplasts was detected by using Leica confocal laser scanning Microscope SP2. Images were processed with PHOTOSHOP software (Adobe Systems, San Jose, CA, USA). E. coli cells in exponential growth stage and with optical density (600 nm) values between 0.4 and 0.45 were collected by centrifugation

at 13 000 g for 15 minutes and the pellets were resuspended in 0.05% low melting point agar to eliminate the uneven distribution of cells on microscope slides. AxioVision AC software (Zeiss, Germany) was used to measure the size of cells. Approximately 200 Janus kinase (JAK) cells were measured each time and three or four check details repeats were done. SigmaPlot 9.0 (SYSTAT Statistics, CA, USA) was used for statistical analysis of the phenotype. To score visible cell constriction sites, more than one hundred septa were counted for each genotype. Septa which were misplaced at or near a cell pole were regarded as polar septa. The percentage of polar septa for each genotype was calculated to reflect the cell division phenotype. Immuno-blot analysis E. coli cells were broken by ultrasonication in the extraction buffer (50 mM Tris HCl pH 8.0, 25 mM NaCl, 2 mM EDTA) and the crude total protein concentration was determined with a Dc protein assay kit (Bio-Rad). 5 μg of proteins were applied to each lane for SDS-PAGE. Immuno-blot analysis was done with polyclonal anti-GFP antibodies (Sigma, G1544). Acknowledgements This work was supported by NSFC Grant (No. 30470879) and PHR Grant (IHLB) to He, and NSFC Grant (No.